Tordylium L. (Apiaceae) Cinsine Ait Taksonların Kloroplast trnL İntron ve trnL-F IGS Bölgelerine Dayalı Moleküler Sistematik Analizi
Dosyalar
Tarih
Yazarlar
Dergi Başlığı
Dergi ISSN
Cilt Başlığı
Yayıncı
Erişim Hakkı
Özet
Apiaceae familyasında yer alan Tordylium L. cinsi Türkiye’de 18 tür ile temsil edilmektedir. Bu çalışmada, ülkemizde yayılış gösteren Tordylium cinsine ait türlerin cpDNA trnL intron ve trnL-trnF dizilerine dayalı moleküler sistematik analizi yapılmıştır. Tordylium cinsine ait örnekler 2015-2021 yıllları arasında yapılan arazi çalışmaları ile doğal habitatlarından toplanmıştır. Örnekler silika jel içinde kurutularak muhafaza edilmiştir. DNA izolasyonları ticari DNA izolasyon kiti kullanılarak yapılmıştır. cpDNA trnL intron, tRNA-(Leu) ve tRNA(Phe) genler arası bölgenin çoğaltılması için trnL-c (5ˈCGAAATCGGTAGACGCTACG3ˈ) ve trnL-f (5ˈATTTGAACTGGTGACACGAG3ˈ) primerleri kullanılmıştır. Elde edilen dizilerin işlenmesi için Bioedit programı, dizilerin hizalanması için ClustalW programı kullanılmıştır. Kontrol edilmiş ve hizalanmış bu diziler nexus formatına MEGA programı ile dönüştürüldükten sonra PAUP* 4.0a152 ve Mr. Bayes v.3.2.7 programları kullanılarak filogenetik ağaçlar elde edilmiştir. Heracleum, Pastinaca ve Angelica cinslerine ait taksonlar dış grup olarak seçilmiştir. Bu çalışma ile Tordylium cinsinde yer alan taksonların filogenetik akrabalık ilişkileri incelenmiştir. Tordylium cinsine ait türlerin trnL intron ve trnL/F genler arası bölgesinin uzunluğu 880bç ile 930bç arasında değiştiği görülmüştür. Tordylium cinsine ait türlerin trnL intron ve trnL-F genler arası bölgesinde biriken mutasyonlar (indel, transisyon, transversiyon) ayrıntılı olarak incelenmiştir.
The genus Tordylium L. is placed in the Apiaceae, and it consists of 18 species in Turkey. Molecular systematics analysis of Tordylium based on cpDNA trnL intron ve trnL-trnLF sequences has been conducted. Species belongs to the genus Tordylium have been collected from natural habitats between 2015-2021 vegetation season. Collected samples have been dried and stored in silica gel. Genomic DNAs have been extracted using plant DNA isolation kit. The chloroplast intergenic spacer between tRNA(Leu) and tRNA(Phe) region have been amplified using trnL-c/trnF-f universal primers. Alignment of the ITS sequence has been done with Bioedit software and then aligned using ClustalX with the default parameters. Aligned sequences have been converted to nexus format using MEGA 6.0. Then PAUP* 4.0a152 have been used to construct the phylogenetic tree. Heracleum, Pastinaca L., Angelica have been used as outgroups. Within this research, phylogenetics analyses of Tordylium taxa have been conducted to detect relationship between species and phylogenetic relationships of genera in Tordylieae tribe were investigated. Among the examined species for trnL intron and trnL/F sequence variation, the length of the trnL intron and trnL/F regions varied from 880 to 930 base pairs. Accumulated mutations (indel, transition, transversion) in the trnL intron and the trnL-F intergeneric region were examined in detail. When the phylogenetic tree obtained using the trnL intron and the trnL-F intergeneric region has been examined, it has been observed that morphologically similar species were grouped together.